samcut is cut for SAM format text.
conda install -c bioconda samcut
Basics:
$ samtools view in.bam | head -n4 | samcut -H | column -t
qname flag rname pos mapq cigar rnext pnext tlen seq qual
HISEQ-2500-1:47:C5V27ANXX:1:1101:12050:5400 99 chr1 629922 23 36M = 629946 60 TCATTAATAATCATAATGGCTATAGCAATAAAACTA BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
HISEQ-2500-1:47:C5V27ANXX:1:1101:16204:8196 163 chr1 629626 23 36M = 629634 44 TCCTTCCCGTACTAATTAATCCCCTGGCCCAACCCG //<<<FB/FBBFFB//</<B</FBBBFF<<B#####
HISEQ-2500-1:47:C5V27ANXX:1:1101:16204:8196 83 chr1 629634 15 36M = 629626 -44 GTACTAATTAATCCCCTGGCCCAACCCGTCATCTAC FFFFF<FFFF<7F/BFB<B<FF<FB<B<BFFBB<B/
HISEQ-2500-1:47:C5V27ANXX:1:1101:8202:71354 99 chr1 629937 23 36M = 629964 63 ATGGCTATAGCAATAAAACTAGGAATAGCCCCCTTT BBB<BFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFF
Flags:
$ samtools view in.bam | head -n4 | samcut -H flag read1 read2 paired dup flags | column -t
flag read1 read2 paired dup flags
99 1 0 1 0 paired,proper_pair,mreverse,read1
163 0 1 1 0 paired,proper_pair,mreverse,read2
83 1 0 1 0 paired,proper_pair,reverse,read1
99 1 0 1 0 paired,proper_pair,mreverse,read1
Expand all flags:
$ samtools view in.bam | head -n4 | samcut -H flag flagss flags | column -t
flag paired proper_pair unmap munmap reverse mreverse read1 read2 secondary qcfail dup supplementary flags
99 1 1 0 0 0 1 1 0 0 0 0 0 paired,proper_pair,mreverse,read1
163 1 1 0 0 0 1 0 1 0 0 0 0 paired,proper_pair,mreverse,read2
83 1 1 0 0 1 0 1 0 0 0 0 0 paired,proper_pair,reverse,read1
99 1 1 0 0 0 1 1 0 0 0 0 0 paired,proper_pair,mreverse,read1
Get stats about flag:
$ function count { sort | uniq -c | sort -nrk1,1; }
$ cols="dup read1 read2 paired"
$ (echo count $cols; samtools view in.bam | samcut $cols | count | head -n5) | column -t
count dup read1 read2 paired
3408 1 1 0 1
3317 1 0 1 1
1656 0 1 0 1
1619 0 0 1 1
Get tags:
$ samtools view in.bam | head -n5 | samcut -H qname SM MD MQ MC XA | column -t
qname SM MD MQ MC XA
HISEQ-2500-1:47:C5V27ANXX:1:1101:12050:5400 23 36 22 36M chrM,+4752,36M,1;
HISEQ-2500-1:47:C5V27ANXX:1:1101:16204:8196 23 36 15 36M chrM,+4456,36M,1;
HISEQ-2500-1:47:C5V27ANXX:1:1101:16204:8196 0 36 23 36M chrM,-4464,36M,0;
HISEQ-2500-1:47:C5V27ANXX:1:1101:8202:71354 23 36 22 36M chrM,+4767,36M,1;
HISEQ-2500-1:47:C5V27ANXX:1:1102:11490:86472 0 36 15 36M .
Histogram of flags and tags:
$ samtools view in.bam | samcut NM read1 proper_pair | count | column -t
4347 0 0 1
4202 0 1 1
774 1 1 1
430 1 0 1
159 2 0 1
88 2 1 1
$ samcut --help
samcut is cut for sam: `samtools view in.bam | samcut`. See --help for examples.
Print the standard 11 columns (qname, flag, ..., qual) with a header row:
$ samtools view in.bam | samcut -H
Print qname, cigar, pos, and tlen only:
$ samtools view in.bam | samcut qname cigar pos tlen
Also print a specific tag:
$ samtools view in.bam | samcut qname cigar pos tlen MD
Separate flag into columns for each bit:
$ samtools view in.bam | samcut -H qname flagss flags
Get a histogram of (read1, secondary, supplementary) flag values:
$ samtools view in.bam | samcut read1 secondary supplementary | sort | uniq -c
Usage: samcut [OPTIONS] [FIELDS]...
Arguments:
[FIELDS]...
Select only these fields. Example: `samcut n qname tlen read1 MD`. See --help for details.
If not supplied, `std` is used.
Standard keys:
key description
----------------------------------------------------------------------------
qname query template name
flag bitwise flag
rname reference sequence name
pos 1-based leftmost mapping position
mapq mapping quality
cigar cigar string
rnext ref. name of the mate/next read
pnext position of the mat/next read
tlen observed template length
seq segment sequence
qual ascii of phred-scaled base quality+33
Flag keys:
key description
----------------------------------------------------------------------------
paired paired-end (or multiple-segment) sequencing technology
proper_pair each segment properly aligned according to the aligner
unmap segment unmapped
munmap next segment in the template unmapped
reverse SEQ is reverse complemented
mreverse SEQ of the next segment in the template is reversed
read1 the first segment in the template
read2 the last segment in the template
secondary secondary alignment
qcfail not passing quality controls
dup PCR or optical duplicate
supplementary supplementary alignment
Speical keys:
key description
----------------------------------------------------------------------------
n One-based index for the input stream
std Expands to the standard 11 columns (qname, flag, ..., qual)
flags Humarn readable flag ("paired,proper_pair,mreverse,read1")
flagss Expands to the 12 flag names (from `samtool flags`)
Options:
-H, --header
Print a header row with column names
-d, --delim <DELIM>
Character to use as delimiter for output
[default: "\t"]
-i, --fill <FILL>
String to fill missing values with (tags are optional and can be missing)
[default: .]
-h, --help
Print help (see a summary with '-h')
-V, --version
Print version